eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	tuberous sclerosis

Disease ID	87
Disease	tuberous sclerosis
Definition	Autosomal dominant neurocutaneous syndrome classically characterized by MENTAL RETARDATION; EPILEPSY; and skin lesions (e.g., adenoma sebaceum and hypomelanotic macules). There is, however, considerable heterogeneity in the neurologic manifestations. It is also associated with cortical tuber and HAMARTOMAS formation throughout the body, especially the heart, kidneys, and eyes. Mutations in two loci TSC1 and TSC2 that encode hamartin and tuberin, respectively, are associated with the disease.
Synonym	adenoma sebaceum adenoma sebaceum syndrome bourneville dis bourneville disease bourneville phacomatosis bourneville phakomatosis bourneville pringle disease bourneville pringle's disease bourneville syndrome bourneville's disease bourneville's syndrome bourneville-pringle disease bourneville-pringle syndrome bourneville-pringle's disease bourneville-pringles disease bournevilles dis brain sclerosis cerebral scleroses cerebral sclerosis disease, bourneville-pringle disease, bourneville-pringle's epiloia phacomatosis phacomatosis, bourneville phakomatosis, bourneville sclerosis brain sclerosis tuberosa sclerosis tuberous sclerosis, cerebral sclerosis, tuberose sclerosis, tuberous syndrome, bourneville syndrome, bourneville's ts - tuberous sclerosis tsc tuberosa sclerosis tuberose sclerosis tuberous sclerosis (disorder) tuberous sclerosis [disease/finding] tuberous sclerosis complex tuberous sclerosis syndrome tuberous sclerosis syndrome (disorder)
Orphanet	ORPHANET:805
OMIM	OMIM:191100 OMIM:611585
DOID	DOID:13515
ICD10	ICD10CM:Q85.1
UMLS	C0041341
MeSH	D014402
SNOMED-CT	SNOMEDCT_US_2016_09_01:7199000
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:99) C0014544 \| epilepsy \| 35 C0205768 \| subependymal giant cell astrocytoma \| 29 C0004114 \| astrocytomas \| 27 C0241961 \| renal angiomyolipoma \| 25 C0004114 \| astrocytoma \| 25 C0206633 \| angiomyolipoma \| 20 C0206633 \| angiomyolipomas \| 14 C0751674 \| lymphangioleiomyomatosis \| 9 C0004352 \| autism \| 7 C0037769 \| infantile spasms \| 6 C1096063 \| intractable epilepsy \| 6 C0022679 \| cystic kidney \| 5 C0022658 \| kidney disease \| 5 C0018552 \| hamartoma \| 4 C0018552 \| hamartomas \| 4 C0007134 \| renal cell carcinoma \| 4 C0017525 \| giant cell tumor \| 4 C0025362 \| mental retardation \| 4 C0024236 \| lymphedema \| 3 C0017525 \| giant cell tumors \| 3 C0007766 \| intracranial aneurysm \| 3 C0022658 \| renal disease \| 3 C0024115 \| lung disease \| 3 C0007766 \| cranial aneurysm \| 3 C0018552 \| hamartomatous \| 2 C0085413 \| autosomal dominant polycystic kidney \| 2 C0022661 \| end-stage renal disease \| 2 C0025202 \| melanoma \| 2 C0085413 \| autosomal dominant polycystic kidney disease \| 2 C0035078 \| renal failure \| 2 C0037769 \| west syndrome \| 2 C1704423 \| congenital lymphedema \| 2 C0035078 \| kidney failure \| 1 C0041327 \| pulmonary tuberculosis \| 1 C0036439 \| scoliosis \| 1 C0020305 \| fetal hydrops \| 1 C0040137 \| thyroid nodule \| 1 C0011649 \| dermoid cysts \| 1 C0078981 \| arachnoid cysts \| 1 C0021670 \| insulinoma \| 1 C0016045 \| fibromas \| 1 C0008487 \| chordoma \| 1 C0026269 \| mitral stenosis \| 1 C0035372 \| rett syndrome \| 1 C0086543 \| cataracts \| 1 C0751674 \| lymphangiomyomatosis \| 1 C0020255 \| hydrocephalus \| 1 C0020502 \| hyperparathyroidism \| 1 C0007134 \| renal cell carcinomas \| 1 C0206681 \| clear cell carcinoma \| 1 C0007113 \| rectal cancer \| 1 C1704423 \| congenital lymphoedema \| 1 C0334359 \| papillary serous carcinoma \| 1 C0007193 \| dilated cardiomyopathy \| 1 C0004352 \| autistic disorder \| 1 C0863027 \| leydig cell tumor of the testis \| 1 C0032326 \| pneumothorax \| 1 C0206654 \| leiomyomatosis \| 1 C0024236 \| lymphoedema \| 1 C0007766 \| intracranial aneurysms \| 1 C0017525 \| giant cell tumour \| 1 C0206701 \| serous carcinoma \| 1 C0206754 \| neuroendocrine neoplasm \| 1 C0026884 \| mutism \| 1 C0022578 \| keratoconus \| 1 C0221002 \| primary hyperparathyroidism \| 1 C0238111 \| lennox-gastaut syndrome \| 1 C0001430 \| adenoma \| 1 C0851578 \| sleep disorders \| 1 C0878544 \| cardiomyopathy \| 1 C0038220 \| status epilepticus \| 1 C0679466 \| cognitive deficits \| 1 C0028768 \| obsessive-compulsive disorder \| 1 C0004936 \| mental disorders \| 1 C0009402 \| colorectal cancer \| 1 C0085113 \| neurofibromatosis \| 1 C0005586 \| bipolar disorder \| 1 C0011570 \| depression \| 1 C1704375 \| hypophosphatemic rickets \| 1 C0017601 \| glaucoma \| 1 C0022660 \| acute renal failure \| 1 C0078981 \| arachnoid cyst \| 1 C0027708 \| nephroblastoma \| 1 C0021670 \| insulinomas \| 1 C0011649 \| dermoid cyst \| 1 C0033975 \| psychosis \| 1 C0151779 \| cutaneous melanoma \| 1 C0040137 \| thyroid nodules \| 1 C0022661 \| chronic renal failure \| 1 C0003493 \| aortic disease \| 1 C0206754 \| neuroendocrine tumors \| 1 C0027708 \| wilms tumor \| 1 C0022660 \| acute kidney failure \| 1 C0041296 \| tuberculosis \| 1 C0020538 \| hypertension \| 1 C0023798 \| lipoma \| 1 C0009241 \| cognitive disorders \| 1 C0242379 \| lung cancer \| 1 C0206754 \| neuroendocrine tumor \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:4) 7248 \| TSC1 \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT 7249 \| TSC2 \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT 3458 \| IFNG \| CTD_human 54997 \| TESC \| OMIM
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:4) 3358 \| HTR2C \| CIPHER 7248 \| TSC1 \| CIPHER;CTD_human 7249 \| TSC2 \| CIPHER;CTD_human 3458 \| IFNG \| CTD_human
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:91) 4363 \| ABCC1 \| 1.391 \| DISEASES 203 \| AK1 \| 2.888 \| DISEASES 250 \| ALPP \| 2.173 \| DISEASES 23245 \| ASTN2 \| 2.156 \| DISEASES 8938 \| BAIAP3 \| 2.685 \| DISEASES 79738 \| BBS10 \| 1.616 \| DISEASES 631 \| BFSP1 \| 1.926 \| DISEASES 800 \| CALD1 \| 2.665 \| DISEASES 83605 \| CCM2 \| 1.926 \| DISEASES 79577 \| CDC73 \| 1.449 \| DISEASES 1139 \| CHRNA7 \| 1.051 \| DISEASES 387836 \| CLEC2A \| 1.008 \| DISEASES 1201 \| CLN3 \| 2.208 \| DISEASES 152330 \| CNTN4 \| 2.684 \| DISEASES 26047 \| CNTNAP2 \| 1.66 \| DISEASES 8451 \| CUL4A \| 1.412 \| DISEASES 192668 \| CYS1 \| 1.41 \| DISEASES 1621 \| DBH \| 1.668 \| DISEASES 1641 \| DCX \| 3.202 \| DISEASES 9681 \| DEPDC5 \| 3.259 \| DISEASES 1741 \| DLG3 \| 1.453 \| DISEASES 1747 \| DLX3 \| 1.71 \| DISEASES 1805 \| DPT \| 1.26 \| DISEASES 80153 \| EDC3 \| 2.802 \| DISEASES 1946 \| EFNA5 \| 1.211 \| DISEASES 1978 \| EIF4EBP1 \| 2.004 \| DISEASES 2018 \| EMX2 \| 3.231 \| DISEASES 2271 \| FH \| 1.733 \| DISEASES 2316 \| FLNA \| 2.42 \| DISEASES 2332 \| FMR1 \| 1.55 \| DISEASES 22862 \| FNDC3A \| 1.526 \| DISEASES 5348 \| FXYD1 \| 1.058 \| DISEASES 10457 \| GPNMB \| 1.041 \| DISEASES 2934 \| GSN \| 1.804 \| DISEASES 3039 \| HBA1 \| 1.037 \| DISEASES 3481 \| IGF2 \| 1.155 \| DISEASES 102723508 \| KANTR \| 1.335 \| DISEASES 3785 \| KCNQ2 \| 1.479 \| DISEASES 284252 \| KCTD1 \| 3.236 \| DISEASES 1316 \| KLF6 \| 1.845 \| DISEASES 889 \| KRIT1 \| 1.778 \| DISEASES 3980 \| LIG3 \| 1.542 \| DISEASES 3984 \| LIMK1 \| 1.025 \| DISEASES 4010 \| LMX1B \| 2.046 \| DISEASES 4043 \| LRPAP1 \| 2.107 \| DISEASES 55777 \| MBD5 \| 1.241 \| DISEASES 4204 \| MECP2 \| 1.778 \| DISEASES 4221 \| MEN1 \| 3.622 \| DISEASES 2315 \| MLANA \| 3.978 \| DISEASES 64223 \| MLST8 \| 1.338 \| DISEASES 4311 \| MME \| 2.155 \| DISEASES 2475 \| MTOR \| 4.1 \| DISEASES 9961 \| MVP \| 1.949 \| DISEASES 4763 \| NF1 \| 3.761 \| DISEASES 4771 \| NF2 \| 2.96 \| DISEASES 54413 \| NLGN3 \| 2.519 \| DISEASES 8828 \| NRP2 \| 1.306 \| DISEASES 9378 \| NRXN1 \| 1.067 \| DISEASES 4983 \| OPHN1 \| 1.74 \| DISEASES 5048 \| PAFAH1B1 \| 2.837 \| DISEASES 55193 \| PBRM1 \| 1.201 \| DISEASES 56034 \| PDGFC \| 1.117 \| DISEASES 8682 \| PEA15 \| 1.457 \| DISEASES 5241 \| PGR \| 1.039 \| DISEASES 5314 \| PKHD1 \| 1.654 \| DISEASES 11145 \| PLA2G16 \| 1.368 \| DISEASES 6490 \| PMEL \| 1.178 \| DISEASES 5587 \| PRKD1 \| 1.341 \| DISEASES 57716 \| PRX \| 1.826 \| DISEASES 5728 \| PTEN \| 1.652 \| DISEASES 5902 \| RANBP1 \| 1.994 \| DISEASES 5906 \| RAP1A \| 1.048 \| DISEASES 5649 \| RELN \| 3.054 \| DISEASES 6195 \| RPS6KA1 \| 2.09 \| DISEASES 9037 \| SEMA5A \| 1.785 \| DISEASES 22941 \| SHANK2 \| 1.584 \| DISEASES 85358 \| SHANK3 \| 2.108 \| DISEASES 6513 \| SLC2A1 \| 1.503 \| DISEASES 23583 \| SMUG1 \| 1.237 \| DISEASES 6628 \| SNRPB \| 1.91 \| DISEASES 27286 \| SRPX2 \| 2.84 \| DISEASES 92335 \| STRADA \| 2.019 \| DISEASES 6840 \| SVIL \| 2.594 \| DISEASES 8831 \| SYNGAP1 \| 1.368 \| DISEASES 1861 \| TOR1A \| 1.359 \| DISEASES 64222 \| TOR3A \| 1.321 \| DISEASES 27010 \| TPK1 \| 2.341 \| DISEASES 22954 \| TRIM32 \| 1.457 \| DISEASES 51060 \| TXNDC12 \| 2.289 \| DISEASES 157680 \| VPS13B \| 2.002 \| DISEASES 641339 \| ZNF674 \| 3.017 \| DISEASES
Locus	(Waiting for update.)

Disease ID	87
Disease	tuberous sclerosis
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:95) HP:0006772 \| Angiomyolipoma \| 34 HP:0009592 \| Astrocytoma \| 28 HP:0002664 \| Neoplasia \| 20 HP:0009717 \| Cortical tubers \| 12 HP:0010615 \| Angiofibromas \| 12 HP:0009730 \| Rhabdomyoma \| 11 HP:0001250 \| Seizures \| 10 HP:0009720 \| Sebaceous adenoma \| 9 HP:0009729 \| Cardiac rhabdomyoma \| 9 HP:0030692 \| Brain tumor \| 7 HP:0009718 \| Subependymal giant-cell astrocytoma \| 7 HP:0000717 \| Autism \| 7 HP:0030731 \| Carcinoma \| 6 HP:0012469 \| Infantile spasms \| 6 HP:0012778 \| Retinal astrocytic hamartoma \| 6 HP:0001249 \| Mental retardation \| 6 HP:0010566 \| Hamartoma \| 6 HP:0000113 \| Polycystic kidney dysplasia \| 6 HP:0002617 \| Aneurysmal dilatation \| 4 HP:0005584 \| Renal cell carcinoma \| 4 HP:0100804 \| Koenen tumor \| 4 HP:0001004 \| Lymphatic obstruction \| 4 HP:0003774 \| End-stage renal failure \| 3 HP:0100543 \| Cognitive deficits \| 3 HP:0004944 \| Cerebral artery aneurysm \| 3 HP:0001919 \| Acute renal failure \| 2 HP:0011097 \| Salaam convulsions \| 2 HP:0000083 \| Renal insufficiency \| 2 HP:0002861 \| Melanoma \| 2 HP:0003764 \| Naevus \| 2 HP:0002539 \| Cortical dysplasia \| 2 HP:0002667 \| Wilms tumor \| 2 HP:0012032 \| Lipoma \| 1 HP:0012054 \| Choroidal melanoma \| 1 HP:0200040 \| Epidermal inclusion cyst \| 1 HP:0004390 \| Hamartomatous polyps \| 1 HP:0012197 \| Insulinoma \| 1 HP:0002133 \| Status epilepticus \| 1 HP:0012056 \| Cutaneous melanoma \| 1 HP:0002084 \| Bifid skull \| 1 HP:0000238 \| Nonsyndromal hydrocephalus \| 1 HP:0001257 \| Spasticity \| 1 HP:0002027 \| Abdominal pain \| 1 HP:0000518 \| Cataract \| 1 HP:0000722 \| Obsessive compulsive disorder \| 1 HP:0011856 \| Pica \| 1 HP:0100033 \| Tic disorder \| 1 HP:0009775 \| Amniotic constriction ring \| 1 HP:0012281 \| Chylous ascites \| 1 HP:0002107 \| Collapsed lung \| 1 HP:0001052 \| port-wine stain \| 1 HP:0000563 \| Conical cornea \| 1 HP:0000969 \| Dropsy \| 1 HP:0000843 \| Hyperparathyroidism \| 1 HP:0002300 \| Muteness \| 1 HP:0010821 \| Gelastic seizures \| 1 HP:0004912 \| Hypophosphatemic rickets \| 1 HP:0000677 \| Failure of development of more than six teeth \| 1 HP:0001638 \| Cardiomyopathy \| 1 HP:0000047 \| Hypospadias \| 1 HP:0100702 \| Arachnoid cyst \| 1 HP:0001289 \| Confusion \| 1 HP:0000501 \| Glaucoma \| 1 HP:0001631 \| Atria septal defect \| 1 HP:0005948 \| Cystic lung disease \| 1 HP:0012531 \| Pain \| 1 HP:0001696 \| Situs inversus totalis \| 1 HP:0010762 \| Chordoma \| 1 HP:0001644 \| Congestive cardiomyopathy \| 1 HP:0000110 \| Renal dysplasia \| 1 HP:0010541 \| Thickened folds on top of scalp \| 1 HP:0000995 \| Beauty mark \| 1 HP:0000716 \| Depression \| 1 HP:0011986 \| Ectopic bone formation \| 1 HP:0000519 \| Cataracts, lenticular, bilateral \| 1 HP:0011540 \| Congenitally corrected transposition of the great arteries \| 1 HP:0000709 \| Psychosis \| 1 HP:0008200 \| Primary hyperparathyroidism \| 1 HP:0000822 \| Hypertension \| 1 HP:0001718 \| Mitral stenosis \| 1 HP:0030430 \| Pinched nerve \| 1 HP:0100634 \| Neuroendocrine neoplasia \| 1 HP:0001669 \| Transposition of the great arteries \| 1 HP:0002108 \| Spontaneous pneumothorax \| 1 HP:0002290 \| Poliosis \| 1 HP:0001342 \| Intracerebral hemorrhage \| 1 HP:0012798 \| Pulmonary myomatosis \| 1 HP:0007206 \| Hemimegalencephaly \| 1 HP:0007302 \| Bipolar disorder \| 1 HP:0002650 \| Scoliosis \| 1 HP:0004947 \| Arteriovenous fistula \| 1 HP:0010614 \| Fibroma \| 1 HP:0009716 \| Subependymal nodules \| 1 HP:0009594 \| Retinal hamartoma \| 1 HP:0004937 \| Pulmonary artery aneurysm \| 1

Disease ID	87
Disease	tuberous sclerosis
Manually Symptom	UMLS \| Name(Total Manually Symptoms:158) C2700542 \| aniridia C2697396 \| rett syndrome C2364108 \| stigma C2073625 \| pleural effusion C1963229 \| retinal detachment C1963154 \| renal failure C1963137 \| hydrocephalus C1962983 \| cataract C1860715 \| giant cell astrocytoma C1691228 \| renal cystic disease C1691228 \| cystic renal disease C1621958 \| glioblastoma multiforme C1608408 \| malignant transformation C1565489 \| renal insufficiency C1565489 \| kidney insufficiency C1555769 \| pulmonary disease C1527429 \| uremia C1378703 \| renal carcinoma C1370419 \| granulosa cell tumor of the ovary C1335743 \| renal leiomyosarcoma C1334300 \| jugular foramen schwannoma C1333970 \| hepatic lipoma C1333962 \| hepatic angiomyolipoma C1332852 \| heart rhabdomyoma C1332852 \| cardiac rhabdomyoma C1321313 \| astrocytic hamartoma C1302836 \| lipomatous hamartoma C1263885 \| cerebral tumor C1145670 \| respiratory failure C1112324 \| multifocal micronodular pneumocyte hyperplasia C1096063 \| intractable epilepsy C0877584 \| tumor hemorrhage C0851578 \| sleep disorders C0751674 \| lymphangiomyomatosis C0751674 \| lymphangioleiomyomatosis C0751378 \| neurologic signs C0751004 \| giant intracranial aneurysm C0748168 \| pulmonary pathology C0748159 \| pulmonary involvement C0700208 \| scoliosis C0700201 \| sleep disturbance C0684550 \| spinal metastases C0679466 \| cognitive deficits C0555198 \| malignant glioma C0545056 \| pseudosarcoma C0524801 \| retinal tumors C0524801 \| retinal tumor C0496892 \| benign kidney tumor C0476073 \| papillary tumor C0428908 \| sinus node dysfunction C0406574 \| pachydermodactyly C0403447 \| chronic renal insufficiency C0392464 \| ventricular aneurysm C0391826 \| lhermitte-duclos disease C0376293 \| stigmata C0349649 \| pulmonary lymphangioleiomyomatosis C0346255 \| renal oncocytoma C0346053 \| atypical fibroxanthoma C0334108 \| polyposis C0332573 \| maculae C0271844 \| parathyroid hyperplasia C0265319 \| facial angiofibromas C0265319 \| facial angiofibroma C0265319 \| adenoma sebaceum C0262405 \| cerebral dysfunction C0259779 \| fibrous dysplasia C0241961 \| renal angiomyolipoma C0241961 \| angiomyolipoma of the kidney C0241961 \| angiomyolipoma of kidney C0238399 \| pulmonary lymphangiomyomatosis C0236048 \| gastric polyposis C0221505 \| cerebral lesions C0221505 \| cerebral lesion C0221505 \| brain lesions C0206731 \| angiofibromas C0206731 \| angiofibroma C0206716 \| glioneuroma C0206711 \| pilomatricoma C0206677 \| adenomatous polyps C0206656 \| embryonal rhabdomyosarcoma C0206633 \| angiomyolipomas C0206633 \| angiomyolipoma C0206632 \| angiolipomas C0205768 \| subependymal giant cell astrocytoma C0162871 \| abdominal aortic aneurysm C0154832 \| coats' disease C0149781 \| spontaneous pneumothorax C0085541 \| frontal lobe epilepsy C0043154 \| white spots C0042373 \| vascular disease C0042133 \| leiomyoma C0040517 \| tourette's syndrome C0038454 \| strokes C0037769 \| west syndrome (ws) C0037769 \| west syndrome C0037769 \| infantile spasms C0037763 \| spasms C0037285 \| skin manifestation C0037284 \| skin lesions C0036572 \| seizures C0036572 \| convulsion C0036341 \| schizophrenia C0035579 \| rickets C0035466 \| rhinophyma C0035411 \| rhabdomyomas C0035411 \| rhabdomyoma C0035067 \| renal artery stenosis C0034887 \| rectal polyps C0033975 \| psychosis C0030312 \| pancytopenia C0029166 \| oral manifestations C0029166 \| oral manifestation C0025362 \| mental retardation C0023601 \| leydig cell tumor C0022680 \| polycystic renal disease C0022679 \| cystic kidneys C0022665 \| renal tumors C0022661 \| end-stage renal failure C0022661 \| end stage renal disease C0022661 \| chronic renal failure C0022658 \| renal disease C0022578 \| keratoconus C0021670 \| insulinoma C0020514 \| hyperprolactinemia C0019080 \| hemorrhage C0018809 \| cardiac tumors C0018809 \| cardiac tumor C0018799 \| heart diseases C0018552 \| hamartomas C0018552 \| hamartoma C0018133 \| graft-versus-host disease C0018023 \| nodular goiter C0017525 \| giant cell tumors C0017525 \| giant cell tumor C0016048 \| fibromatosis C0016045 \| fibromas C0016045 \| fibroma C0015411 \| eye findings C0014544 \| epilepsy C0013930 \| tumor embolism C0011351 \| enamel hypoplasia C0009951 \| convulsions C0008487 \| chordoma C0007798 \| intraventricular neoplasm C0007766 \| intracranial aneurysms C0007766 \| intracranial aneurysm C0007134 \| renal cell carcinomas C0007134 \| renal cell carcinoma C0006118 \| brain tumors C0006118 \| brain tumor C0005586 \| bipolar disorder C0004352 \| childhood autism C0004352 \| autism C0004114 \| astrocytomas C0004114 \| astrocytoma C0003500 \| subvalvular aortic stenosis C0002940 \| aneurysm C0000889 \| acanthosis nigricans
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:69) C0014544 \| epilepsy \| 39 C1860715 \| giant cell astrocytoma \| 34 C0205768 \| subependymal giant cell astrocytoma \| 31 C0004114 \| astrocytomas \| 28 C0241961 \| renal angiomyolipoma \| 26 C0004114 \| astrocytoma \| 24 C0206633 \| angiomyolipoma \| 18 C0206633 \| angiomyolipomas \| 15 C0206731 \| angiofibromas \| 12 C0037763 \| spasms \| 10 C0751674 \| lymphangioleiomyomatosis \| 9 C0035411 \| rhabdomyomas \| 9 C1332852 \| cardiac rhabdomyoma \| 9 C0035411 \| rhabdomyoma \| 8 C1321313 \| astrocytic hamartoma \| 7 C0037769 \| infantile spasms \| 6 C0004352 \| autism \| 6 C1096063 \| intractable epilepsy \| 6 C0036572 \| seizures \| 6 C0018552 \| hamartoma \| 6 C0006118 \| brain tumor \| 5 C0007134 \| renal cell carcinoma \| 4 C0265319 \| facial angiofibromas \| 4 C0265319 \| facial angiofibroma \| 4 C0018552 \| hamartomas \| 4 C0025362 \| mental retardation \| 4 C0024115 \| lung disease \| 3 C0022658 \| renal disease \| 3 C0022680 \| polycystic kidney disease \| 3 C0017525 \| giant cell tumor \| 2 C0037284 \| skin lesions \| 2 C0037769 \| west syndrome \| 2 C0349649 \| pulmonary lymphangioleiomyomatosis \| 2 C0007766 \| intracranial aneurysm \| 2 C0752303 \| urological manifestations \| 2 C0679466 \| cognitive deficits \| 2 C1112324 \| multifocal micronodular pneumocyte hyperplasia \| 2 C0221505 \| brain lesions \| 2 C0017525 \| giant cell tumors \| 2 C0206731 \| angiofibroma \| 1 C0751674 \| lymphangiomyomatosis \| 1 C0004352 \| autistic disorder \| 1 C0005586 \| bipolar disorder \| 1 C0334108 \| polyposis \| 1 C0021670 \| insulinoma \| 1 C0022661 \| chronic renal failure \| 1 C0035372 \| rett syndrome \| 1 C0008487 \| chordomas \| 1 C0003493 \| aortic disease \| 1 C0007766 \| intracranial aneurysms \| 1 C0017601 \| glaucoma \| 1 C0006118 \| brain tumors \| 1 C0033975 \| psychosis \| 1 C0022578 \| keratoconus \| 1 C0016045 \| fibromas \| 1 C0078981 \| arachnoid cysts \| 1 C0851578 \| sleep disorder \| 1 C0008487 \| chordoma \| 1 C0016045 \| fibroma \| 1 C0041341 \| adenoma sebaceum \| 1 C0149781 \| spontaneous pneumothorax \| 1 C0029166 \| oral manifestation \| 1 C0019080 \| hemorrhage \| 1 C0206711 \| pilomatricoma \| 1 C0016048 \| fibromatosis \| 1 C0035078 \| renal failure \| 1 C0277787 \| stigmata \| 1 C0238399 \| pulmonary lymphangiomyomatosis \| 1 C0002940 \| aneurysm \| 1

Manually Genotype(Total Manually Genotypes:2)
Gene	Mutation	DOI	Article Title
TSC2	-	doi:10.1038/gim.2015.51	Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability
TSC1	-	doi:10.1038/gim.2015.51	Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:112)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs113488022	25346165	673	BRAF	umls:C0041341	BeFree	The diagnostic subgroups of tuberous sclerosis complex were not correlated with BRAF(V600E) in patients with SEGA (P = 0.533).	0.000271442	2014	BRAF	7	140753336	A	T,G,C
rs118203352	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132925741	T	G
rs118203360	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132925678	GA	-
rs118203387	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132923365	C	T
rs118203396	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132921943	A	G
rs118203423	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132921437	C	T,G
rs118203426	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132921429	A	C
rs118203427	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132921418	G	A
rs118203434	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132921367	G	A
rs118203438	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132921362	C	T,A
rs118203447	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132912446	A	T,C
rs118203451	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132912382	AT	-
rs118203464	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132912293	TG	-
rs118203474	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132911509	G	A
rs118203478	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132911492	-	A
rs118203479	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132911492	CA	-
rs118203501	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132910682	T	-
rs118203506	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132910577	G	-
rs118203527	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132906735	TTCT	-
rs118203542	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132906053	G	A
rs118203550	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132905997	CT	-
rs118203557	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132905885	TTTCATCAGCACTGCCGCAGGGC	-
rs118203576	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132905818	T	C
rs118203595	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132905687	CTTT	-
rs118203597	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132905674	GT	-
rs118203603	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132905618	-	T
rs118203606	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132905615	G	A
rs118203610	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132905580	C	T,G
rs118203631	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132903785	G	A
rs118203657	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132903665	G	A
rs118203682	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132902640	G	A
rs118203707	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132900829	GTTT	-
rs118203712	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132900771	C	-
rs121964862	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2063042	C	T
rs137853977	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2057156	AT	-
rs137853982	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2054311	-	G
rs137853995	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2074254	T	C
rs137854071	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2071908	C	-
rs137854076	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2079350	TG	-
rs137854083	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2085302	C	-
rs137854128	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2074303	TCA	-
rs137854155	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2076094	C	T
rs137854175	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2085001	ACAA	-
rs137854210	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2081680	-	T
rs137854218	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	PKD1;TSC2	16	2088293	CGGCTCCGCCACATCAAG	-
rs137854249	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2086816	TT	-
rs137854250	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2072985	TAGG	-
rs137854261	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2086793	GAA	-
rs137854298	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2061980	T	G
rs137854314	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2080168	G	-
rs137854317	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	PKD1;TSC2	16	2088326	G	-
rs137854331	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2086372	CAT	-
rs137854337	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2071896	-	TACT
rs137854359	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2055489	-	A
rs137854363	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2084402	CT	-
rs137854368	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2084337	TG	-
rs137854397	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	PKD1;TSC2	16	2088318	GCCAGCGGGTAGGGAATATGGGGCTCC	-
rs28934872	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2070571	G	A
rs376285784	21407264	7249	TSC2	umls:C0041341	BeFree	One TSC2 mutation, R505Q, was identified in a patient with intellectual disability, seizures and autistic spectrum disorder but who did not fulfil the diagnostic criteria for TSC.	0.493815383	2011	TSC2	16	2064342	G	A
rs397514793	21268779	7248	TSC1	umls:C0041341	BeFree	A novel TSC1 mutation (c.1964delA) in a Chinese patient with tuberous sclerosis complex.	0.465677729	2011	TSC1	9	132905614	T	-
rs397514842	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132904410	C	T
rs397514867	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132912329	G	C
rs397514871	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132897538	G	A
rs397514875	NA	7248	TSC1	umls:C0041341	CLINVAR	NA	0.465677729	NA	TSC1	9	132897564	T	-
rs397515009	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2084385	-	AGCAAGTCCAGCTCCTC
rs397515087	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2079380	C	A,G
rs397515226	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2071796	AG	-
rs397515297	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2064275	G	A,T
rs45438205	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2080365	C	T
rs45438205	21332470	7249	TSC2	umls:C0041341	BeFree	Functional characterization of the TSC2 c.3598C>T (p.R1200W) missense mutation that co-segregates with tuberous sclerosis complex in mildly affected kindreds.	0.493815383	2012	TSC2	16	2080365	C	T
rs45451497	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2080179	C	T
rs45462194	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2081595	G	A
rs45466296	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2057179	G	A
rs45469298	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2070570	C	G,T
rs45472701	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	PKD1;TSC2	16	2088236	C	T
rs45479192	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2086292	C	T
rs45483392	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2087897	C	T
rs45488893	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2056245	G	A
rs45491698	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2079160	G	A,C
rs45501492	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2079674	G	A,T
rs45507199	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	PKD1;TSC2	16	2088294	G	A,C,T
rs45512692	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	NTHL1;TSC2	16	2048649	A	T
rs45515894	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2062561	G	A
rs45516293	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2084965	A	C
rs45517096	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2053340	A	G
rs45517118	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2056242	G	A,T
rs45517148	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2060790	G	A,T
rs45517150	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2060655	G	A
rs45517159	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2062006	C	T
rs45517169	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2062982	C	T
rs45517174	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2064270	A	G
rs45517179	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2064341	C	T
rs45517182	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2064428	G	A,T
rs45517213	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2072251	G	A
rs45517214	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2072293	T	G
rs45517222	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2072879	C	T
rs45517229	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2074198	A	C
rs45517246	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2075797	A	G,T
rs45517252	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2075893	G	C
rs45517258	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2076141	C	G,T
rs45517259	17120248	7249	TSC2	umls:C0041341	BeFree	Unusually mild tuberous sclerosis phenotype is associated with TSC2 R905Q mutation.	0.493815383	2006	TSC2	16	2076142	G	A
rs45517259	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2076142	G	A
rs45517281	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2079171	T	C
rs45517327	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2084318	G	T
rs45517337	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2084540	C	T
rs45517340	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2084597	C	T
rs45517352	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2085233	C	A,T
rs45517386	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2086872	G	A,C,T
rs45517395	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2088117	G	A,C
rs45517398	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2088129	T	C
rs45517399	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	TSC2	16	2088140	G	A,C,T
rs45517412	NA	7249	TSC2	umls:C0041341	CLINVAR	NA	0.493815383	NA	PKD1;TSC2	16	2088293	C	G,T

GWASdb Annotation(Total Genotypes:1)
Chr	Pos	SNP_Id	RefGene	EnsemblGene	ENCODE_Factor	ENCODE_TFBS	Chromosome_interaction	GTEx_eQTL	SNP_TFBS_affinity_GWAS3D	SNP_miRNA_target_affinity_PolymiRTS	SNP_splicing_effect_Skippy	SNP_splicing_effect_MutPred_Splice	SNP_ns_protein_effect_dbNSFP	SNP_syn_effect_Silva	SNP_phosphorylation_effect_PhosSNP	PhastCons_score	PhyloP_score	GERP++_RS	Segway_state	Ancestral_allele	ESP_AF	ESP_AFR	ESP_AFR	ESP_EUR	TG_ASN	TG_AMR	TG_AFR	TG_EUR	Type	Consequence	bStatistic	EncH3K27Ac	EncH3K4Me1	EncH3K4Me3	EncNucleo	OMIM	Clinvar
12	117527314	rs11068326	NR_031766,TESC	NM_001168325,TESC	NM_017899,TESC	ENST00000470612,ENSG00000088992	ENST00000392545,ENSG00000088992	ENST00000335209,ENSG00000088992	ENST00000462502,ENSG00000088992	ENST00000482176,ENSG00000088992	TFP.SETDB1	TFP.TRIM28	NA	chr12,117520001,117530000,chr12,117550001,117560000,28,Hi-C	chr12,117520001,117530000,chr14,64900001,64910000,4,Hi-C	chr12,117520001,117530000,chr13,85420001,85430000,6,Hi-C	chr12,117520001,117530000,chr19,7250001,7260000,6,Hi-C	NA	Nhp6a-primary,4.3542	Obox5_3963,1.4206	LM69,2.3691	LM77,1.9375	LM226,3.7809	NA	NA	NA	NA	NA	NA	0.000	-1.381	-4.55	GE0	T	NA	NA	NA

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Disease ID	87
Disease	tuberous sclerosis
Case	(Waiting for update.)